Extinction is a natural selection process. Should humans strive to preserve a representative sample of all biomes or aquatic zones? Why should humans be concerned with the extinction rate?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Biomes and Diversity
Extinction is a natural selection process. Should humans strive to preserve a representative sample of all biomes or aquatic zones? Why should humans be concerned with the extinction rate?
Your initial post should be at least 300 words in length. Support your claims with at least two references in addition to your text in support of your position. Cite your sources in APA format.

In 2003, the United Nations General Assembly considered three proposals aimed at human cloning. The proposal strongly pushed by the United States:

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

In 2003, the United Nations General Assembly considered three proposals aimed at human cloning. The proposal strongly pushed by the United States:
A. called for a ban of reproductive cloning.

B. called for the fate of therapeutic cloning to be determined by individual nations.

C. called for a ban of all types of cloning.

D. argued that the issue should be deferred for a couple of years.
Reset Selection

Define ageism, and explain the contributions of gerontology to changing views about old age. Write 300 words supply references APA format

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Define ageism, and explain the contributions of gerontology to changing views about old age. Write 300 words supply references APA format

What is your opinion? Is sexual orientation social or biological?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

sexual orientation? Many believe sexual orientation is biological in nature while others believe social experiences determine sexual orientation.

What is your opinion? Is sexual orientation social or biological?

Visit Population Biology and complete the virtual lab. This lab gives you the opportunity to explore the affects of competition on population growth. Follow the instructions on the Population Biology Submission Form. Using this worksheet, you will answer the lab questions and fill in the table on the attached Population Biology Submission Form.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.
Visit Population Biology and complete the virtual lab. This lab gives you the opportunity to explore the affects of competition on population growth. Follow the instructions on the Population Biology Submission Form. Using this worksheet, you will answer the lab questions and fill in the table on the attached Population Biology Submission Form.

Extinction is a natural selection process. Should humans strive to preserve a representative sample of all biomes or aquatic zones? Why should humans be concerned with the extinction rate?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Extinction is a natural selection process. Should humans strive to preserve a representative sample of all biomes or aquatic zones? Why should humans be concerned with the extinction rate?
Your initial post should be at least 150 words in length. Support your claims with at least two references in addition to your text in support of your position. Cite your sources in APA format.

Design a factsheet for seeldling production of broccoli.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Design a factsheet for seeldling production of broccoli.

Discuss toxicity and the factors that modify toxic responses. Also, incorporate the following: absorption, access to target cell, degree of biotransformation or bioactivation, and rate of elimination on one known harmful substance.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Discuss toxicity and the factors that modify toxic responses. Also, incorporate the following: absorption, access to target cell, degree of biotransformation or bioactivation, and rate of elimination on one known harmful substance.

By the late 1800s scientists had determined that heritable information existed as discrete units called genes, which were located on____?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

By the late 1800s scientists had determined that heritable information existed as discrete units called genes, which were located on____?

the onion root tip section under the microscope. Note how the onion cells’ DNA/chromosomes have been stained to appear dark purple.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

the onion root tip section under the microscope. Note how the onion cells’ DNA/chromosomes have been stained to appear dark purple. Consider each individual cell, and use the datas to record which phase of cell division it’s in. According to datas, interphase has the highest number of cells while telophase has the lowest number of cells in this phase.
which subphase of mitosis seems to require the most time? why this particular subphase of mitosis would require the most time?

Is it possible for homologous chromosomes to have any of the same alleles on them? Explain

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Is it possible for homologous chromosomes to have any of the same alleles on them? Explain

a.Mutations that result in proteins with altered shape may…circle your response harm cells OR benefit cells OR either harm or benefit cells

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

a.Mutations that result in proteins with altered shape may…circle your response
harm cells OR benefit cells OR either harm or benefit cells
b.explain your answer!
c.Do all mutations cause an alteration in cell function? If you say yes, then explain your answer. If you say no, then give two reasons why all mutations do not cause cell function alterations.

7a.A male hemophiliac has a child with a woman who is a carrier for this condition. What is the probability that a MALE child will have normal blood clotting?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

7a.A male hemophiliac has a child with a woman who is a carrier for this condition. What is the probability that a MALE child will have normal blood clotting?
What is the probability that they will have a male child who is a hemophiliac?
7b. A male who is normal for blood clotting fathers a child with a woman who is a carrier for this condition. What are the chances that a FEMALE child will have normal blood clotting?
7c. In humans, the condition for normal vision dominates red-green color blindness. This gene is linked to the X chromosome. A male with normal vision and a color-blind female have a child.
If the child is a male, what is the probability that he will be color blind?
7d. The woman in problem 7c has a daughter that is color-blind. She claims the father is the man in problem 7c. He claims that’s impossible. Can you support the argument of either parent? If yes, which one and why?

.In a particular plant, leaf color and leaf shape are controlled by two linked genes. Leaves of the wild-type plant are red. A recessive mutation in this gene causes white leaves. Wild-type leaves ar4e pointed, and a recessive mutation in this gene causes them to be smooth. The following cross was performed:

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

a.In a particular plant, leaf color and leaf shape are controlled by two linked genes. Leaves of the wild-type plant are red. A recessive mutation in this gene causes white leaves. Wild-type leaves ar4e pointed, and a recessive mutation in this gene causes them to be smooth. The following cross was performed:
Heterozygous red, pointed X Homozygous white, smooth
RESULTS: 40 white, smooth
39 red, pointed
10 white, pointed
11 red, smooth
What is the recombination frequency between the gene for color and the gene for shape?
What is the distance between these two genes?
b. Three linked genes (v, p and b) are studied to begin a genetic map. Crosses were carried out and 10,000 progeny were analyzed for each cross. Of 10,000 progeny, there were:
2207 recombinants between v and p
1489 recombinants between p and b
718 recombinants between b and v
Use this information to determine the order of these genes on the chromosome.

Voice in writing is much like your speaking voice. You have tones and inflections, dialect and nuances that make you distinctive. What are the elements of your writing voice?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Voice in writing is much like your speaking voice. You have tones and inflections, dialect and nuances that make you distinctive. What are the elements of your writing voice?

How is environmental science helpful to conservation biology?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

How is environmental science helpful to conservation biology?

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one one each side. In the Saguaro arm length is controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths (a). If two cacti that are heterozygous for arm length are mated, the offspring would be expected to show which phenotypic ratio?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one one each side. In the Saguaro arm length is controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths (a). If two cacti that are heterozygous for arm length are mated, the offspring would be expected to show which phenotypic ratio?

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one one each side. In the Saguaro arm length is controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths (a). If two cacti that are heterozygous for arm length are mated, the offspring would be expected to show which phenotypic ratio?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Saguaro cacti are very tall cylindrical plants that usually have two L-shaped arms, one one each side. In the Saguaro arm length is controlled by a single gene with arms of the same length (A) being dominant to arms of different lengths (a). If two cacti that are heterozygous for arm length are mated, the offspring would be expected to show which phenotypic ratio?

In wolves the normal coat color (N) is dominate to black (n) and brown eyes (B) are dominate to blue (b). If a homozygous normal color coat wolf with brown eyes is crossed with a homozygous black coat wolf with blue eyes what is the phenotype of the F1 progeny?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

In wolves the normal coat color (N) is dominate to black (n) and brown eyes (B) are dominate to blue (b). If a homozygous normal color coat wolf with brown eyes is crossed with a homozygous black coat wolf with blue eyes what is the phenotype of the F1 progeny?

A woman who is heterozygous for color vision married a man with normal color vision. If they have 2 boys with normal color vision, what is he probability that their next male child will be phenotypically normal?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

A woman who is heterozygous for color vision married a man with normal color vision. If they have 2 boys with normal color vision, what is he probability that their next male child will be phenotypically normal?

GIVEN THE FOUR SEQUENCES:

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

GIVEN THE FOUR SEQUENCES:
1. AAACTGAAGCTTACCTATCGGTCGAT
2. AAGCTGATGCTTACCTATCGATCAAC
3. AAACTGGAGCTTATCGATCGAT
4. AAGCTGGAGCTTACCTATCGGTCAAC

Write out an Alignment for these four sequences  

After mitosis has finished, how many cells have been produced?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

After mitosis has finished, how many cells have been produced?

Answer the questions below for each potential change in the mRNA, amino acid and phenotype that would result from the mutation. Also include the type of mutation.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Answer the questions below for each potential change in the mRNA, amino acid and phenotype that would result from the mutation. Also include the type of mutation.
1A. GCG to CCG
mRNA Change (e.g. AUC to AUG)
Amino Acid change, if any (e.g. leucine to methionine)
Type of Mutation (e.g. silent, missense, nonsense)
Effect on Phenotype (coat color – dark to white, or abnormal)

B. GCG to GCA
mRNA Change (e.g. AUC to AUG)
Amino Acid change, if any (e.g. leucine to methionine)
Type of Mutation (e.g. silent, missense, nonsense)
Effect on Phenotype (coat color – dark to white, or abnormal)

C. GCT to ACT
mRNA Change (e.g. AUC to AUG)
Amino Acid change, if any (e.g. leucine to methionine)
Type of Mutation (e.g. silent, missense, nonsense)
Effect on Phenotype (coat color – dark to white, or abnormal)

D. GCA to ACA
mRNA Change (e.g. AUC to AUG)
Amino Acid change, if any (e.g. leucine to methionine)
Type of Mutation (e.g. silent, missense, nonsense)
Effect on Phenotype (coat color – dark to white, or abnormal)

2.In words and with the aid of diagrams, compare and contrast in detail the process of transcription in prokaryotes versus eukaryotes. Be sure to note differences or similarities in terms of locations, initiator factors/sequences, enzymes, RNA processing and timing of transcription and translation

1a. Cystic fibrosis is caused by a recessive allele that results in defective chloride channels in cell membranes. This causes chloride to accumulate outside cells and a build-up of mucus in various organs (particularly the lungs and liver).

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

1a. Cystic fibrosis is caused by a recessive allele that results in defective chloride channels in cell membranes. This causes chloride to accumulate outside cells and a build-up of mucus in various organs (particularly the lungs and liver).
Genetic testing has determined that a couple are both carriers of this allele(meaning they have a heterozygous condition). What is the probability that they will produce a child with cystic fibrosis?_______________
b. Huntington’s disease is one of the few lethal genetic disorders that is due to a dominant gene.This is a degenerative disease of the nervous system that does not develop until later in life. Why don’t we find many lethal dominantly-inherited disorders?
c. Pattipan squash are either white or yellow. You start growing
pattipans and find out that, if you want to get white pattipans, then at least one of the parents must be white. Which color is dominant?
d. Humans may have Rh+ blood or Rh- blood. Rh+ means the
person has a certain group of proteins on the surface of their red blood cells. In humans, Rh+ blood dominates Rh-. Normal hemoglobin dominates sickle cell hemoglobin (assume this gene is on a different chromosome than the one for Rh). If one parent is heterozygous for both genes and the other parent is heterozygous for Rh and homozygous for normal hemoglobin, what is the probability that they will produce a child who is homozygous dominant for both traits?

1a. Think about the cells that are found at the tip of a plant root. What percentage of these cells would you expect to be in the mitotic phase? Over 10% OR Less than 10% b. Why?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

1a. Think about the cells that are found at the tip of a plant root. What percentage of these cells would you expect to be in the mitotic phase?
Over 10% OR Less than 10%
b. Why?

2. which subphase(interphase/prophase/metaphase/anaphase/telophase) of mitosis seems to require the most time? why?

What would be the genotype of a pea plant with axial flowers?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

What would be the genotype of a pea plant with axial flowers?
Answer

a A

b AA

c Aa

d AA or Aa
After meiosis, the possible genotypes for the GAMETES of a pea plant heterozygous for round seeds would be
Answer

a Rr

b R only

c R or r

d R or R

A recently discovered mutant dragon was found to have extra long claws (C) and rather than breathing fire, emits a stream of liquid nitrogen (N), instantly freezing its victims. Though rare, both of these traits are actually dominant. One possible genotype for the gametes produced by a dragon that is heterozygous for both these traits would be
Answer

a Cc

b Cf

c C

d Can’t think now – I have a brain freeze – ouch – stop that!
A couple decides that they would like to have 4 children: 2 boys and 2 girls. They start by having 2 boys in a row. After realizing how wild boys can be sometimes, they are a little uncertain if they want to try for two more kids, since they might end up with 2 more boys! What is the probability that they will have two more boys, giving them a total of 4 boys?
Answer

a 25%

b 50%

c 100%

d 0%
Sex-linked genes are frequently found on the Y as well as the X chromosome.
Answer
a True
b False

if a man and a woman were able to form diploid gametes (sperm & eggs) by mitosis instead of meiosis, the resulting fertilized egg would have a ploidy of _____ and would have a total of ______ chromosomes.
Possible Answers for X and Y: 1N, 2N, 3N, 4N, 23, 46, 69, 92, 184

What are the possible genotypes for a person with Type A blood?
Answer

a IAIA or IAi

b AA or Aa

c IA only

d A only

Snapdragon flowers exhibit incomplete dominance for flower color. Red flowers have 2 copies of the CR allele, white flowers have 2 copies of the CW allele and pink flowers have one copy of each allele (their genotype would be CRCW). If crossing white flowers with pink flowers, what would be the ratio of white flowers to pink flowers in the resulting offspring?
Answer

a 2:1

b 1:2

c 1:0

d 1:1

Consider the pedigree on page 4 of the lab handout. What does the darkened round symbol represent?
Answer

a A man with a dominant phenotype

b A woman with a dominant phenotype

c A woman with a recessive phenotype

d A man with a recessive phenotype

A. Indicate with where each of the processes listed below take place in the cell. Be specific in your answers.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

A. Indicate with where each of the processes listed below take place in the cell. Be specific in your answers.

i. Transcription of mRNA
ii. Transcription of rRNA
iii. Translation of mRNA coding for ribosomal proteins
iv. Assembly of individual ribosomal subunits
v. Splicing of mRNA

B.

For (a), (b), & (c) indicate:

Direction the template is read by the RNA Polymerase/ribosome
Direction in which the product is synthesized:

C. What are the components of ribosomal subunits?

D. Name one of the components of the mRNA splicing machinery.

Compare and contrast the transport of molecules across the plasma membrane of a typical animal cell with the transport of molecules across the nuclear envelope.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Compare and contrast the transport of molecules across the plasma membrane of a typical animal cell with the transport of molecules across the nuclear envelope.

Blue Cross/Blue Shield of Transylvania (BCBST) has presented a managed care contract to Jones Biology Group (Jones) containing a most favored nations clause.

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

2. Blue Cross/Blue Shield of Transylvania (BCBST) has presented a managed care contract to Jones Biology Group (Jones) containing a most favored nations clause. Specifically, the clause requires that Jones not to “charge fees to BCBST higher than the fees Jones accepts from any other non-governmental group, group plan or panel.” These clauses are enforceable in some states and unenforceable in others. Discuss the pros and cons of enforceability applying the knowledge you have obtained from the course. Specifically apply managed care and contract law concepts and principles to the fact pattern.”

Present the pros and cons on the farming of animals for the manufacture of goods rather than food? Is it a justifiable practice?

Is this your question too? Our experts can help you prepare an answer and you can learn from the assignment. You can email your assignment to assignment@tutehelp.com or Click Here to Instantly Upload Assignment Online or visit our Service Page to know more about us.

Present the pros and cons on the farming of animals for the manufacture of goods rather than food? Is it
a justifiable practice?